Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Article
Ramiro Enrique Cepeda Luna, Gabriel Arturo Pazmiño Solys, Washington Marcelo Gallardo Medina, Juan Enrique Ramos Guevara, Mónica Paulina Espinoza Guano and Luis Leonardo Guerrero Garcés
Cleaner production and the management of effluents in the Ecuadorian craft fisheries sector
Glo. Adv. Res. J. Agric. Sci. June 2017 Vol: 6(4): - [Abstract] [Full Text - PDF] (135 KB)
Review
Peter Stride and Kylie Lopes Floro
Eyam’s Guardian Gene; C282Y, H63D or Delta 32?
Glo. Adv. Res. J. Agric. Sci. July 2015 Vol: 4(6): - [Abstract] [Full Text - PDF] (220 KB)
Original Research Articles
Salinas-Castro A, Nava-Díaz C, Luna- Rodríguez M, San Martín-Romero E, Rivera-Fernández A, Trigos A
Antagonistic bacteria affecting the Golden cyst potato nematode (Globoderarostochiensis Woll.) in the region of Perote, Veracruz, México
Glo. Adv. Res. J. Agric. Sci. February 2016 Vol: 5(2): - [Abstract] [Full Text - PDF] (180 KB)
Rehab M. Rizk; Magda I. Soliman and Eman M. EL-Zayat
Cytotoxic and Genotoxic Effects of some Narcotic plant extracts using Higher Plant Bioassay
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (1,402 KB)
Fernando Mejia Sanchez, Marisol Rodríguez Albarrán, J. Amado López Arriaga and Julieta Castillo Cadena
Heterogeneity of GST enzymatic activity before and after treatment in patients with breast cancer: pilot study
Glo. Adv. Res. J. Agric. Sci. July 2017 Vol: 6(7): - [Abstract] [Full Text - PDF] (311 KB)
Pramudji Hastuti, Izza Zukhrufia, Made Harumi Padmaswari, Afifah Nuraini and Ahmad Hamim Sadewa
Susceptibility of Lys656Asn Polymorphism of Leptin Receptor Gene to Hypertension in Obese Javanese subjects of Indonesia
Glo. Adv. Res. J. Agric. Sci. April 2016 Vol: 5(4): - [Abstract] [Full Text - PDF] (208 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 626
Printed 413
Downloaded 274
Powered By iPortal Works