Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals


Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.


1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.


Accepted 14 March, 2017



Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles

Original Research Articles
I Wayan Suardana, Annisa Putri Cahyani and Komang Januartha Putra Pinatih
Probiotic Potency and Molecular Identification of Lactic Acid Bacteria Isolated from Bali Cattle’s Colon, Indonesia
Glo. Adv. Res. J. Agric. Sci. May 2016 Vol: 5(5): - [Abstract] [Full Text - PDF] (124 KB)
Elsayed M. Elazazi, Nahed M. Nour El-Din, Maryam S. Al-Qahtani and Naema El-Tanger
Effects of Storage Conditions, Storage Periods and Dormancy-Breaking Treatments on the Viability and Germination of Citrullus colocynthis (L.) Schrad Seeds
Glo. Adv. Res. J. Agric. Sci. October 2017 Vol: 6(10): - [Abstract] [Full Text - PDF] (3,654 KB)
Shimekit Tadele, Firew Mekbib and Kassahun Tesfaye
Genetic Diversity of Coffee (Coffea arabica L.) Landraces from Southern Ethiopia as Revealed by Inter Simple Sequence Repeat Marker
Glo. Adv. Res. J. Agric. Sci. January 2014 Vol: 3(1): - [Abstract] [Full Text - PDF] (607 KB)
Asmaa A. Alharbi
Molecular Characterization Using 16S rRNA Gene of Isolated Bacterial Genera Associated With Mango Cultivation in Jazan province, South West KSA
Glo. Adv. Res. J. Agric. Sci. September 2017 Vol: 6(9): - [Abstract] [Full Text - PDF] (1,669 KB)
Mekkawy, IAA; Ahmed S. A. Harabawy; U. M. Mahmoud
Intra- and inter-specific variations in some isoenzymes and in eye-lens nucleus and muscle proteins of three Lethrinus species from the Red Sea at Hurghada, Egypt.
Glo. Adv. Res. J. Agric. Sci. February 2016 Vol: 5(2): - [Abstract] [Full Text - PDF] (1,391 KB)
M Owusu-Akyaw, PK Baidoo. and MB Mochiah
The RNA-seq methodology and its revolution on analysis of transcriptome and gene expression.
Glo. Adv. Res. J. Agric. Sci. November 2014 Vol: 3(11): - [Abstract] [Full Text - PDF] (135 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed


Viewed 742
Printed 434
Downloaded 300
Powered By iPortal Works