Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Review
Peter Stride and Kylie Lopes Floro
Eyam’s Guardian Gene; C282Y, H63D or Delta 32?
Glo. Adv. Res. J. Agric. Sci. July 2015 Vol: 4(6): - [Abstract] [Full Text - PDF] (220 KB)
Original Research Articles
Ayat A Sayed, Sahar EM EL-Deek, Mona A EL-Baz, Dina Sabry, Aliaa Al-Rageaey, Aishaa Mansey, Fatma Y Meligy and Khaled Abdelaziz
Exosomes Derived from Bone Marrow Mesenchymal Stem Cells Restore Cisplatin Induced Ovarian Damage by Promoting Stem Cell Survival, Meiotic, and Apoptotic Markers
Glo. Adv. Res. J. Agric. Sci. June 2017 Vol: 6(6): - [Abstract] [Full Text - PDF] (5,455 KB)
So Makabe, Kynet Kong, Hiroyuki Niimi, Ikuo Nakamura
Growth profiles of transgenic tobacco plants expressing rice 45S rRNA gene
Glo. Adv. Res. J. Agric. Sci. February 2017 Vol: 6(2): - [Abstract] [Full Text - PDF] (2,139 KB)
Tarek AA Moussa Rasha H ElSherif, Mohamed EA. Dawoud, Reham A. Dwedar and Nahla T. Muhammedy
Fecal carriage of extended-spectrum β-lactamase-producing Enterobactearicae: a comparative study between hospitalized and non-hospitalized patients.
Glo. Adv. Res. J. Agric. Sci. June 2014 Vol: 3(5): - [Abstract] [Full Text - PDF] (139 KB)
Mohamed T. Shaaban, M. Attia, Eman I. Mowafy, Azza Sh. Turky and Nemat M. Awad
Identification and Improving Antibiotic Production by Some Bacteria Isolated From Egyptian Soil
Glo. Adv. Res. J. Agric. Sci. September 2015 Vol: 4(9): - [Abstract] [Full Text - PDF] (1,296 KB)
Iman K.A. Abdel Gadir, Marmar A. El Siddig, Hayfa H.A. Ibrahim and Adil A. El Hussein
Factors Affecting Agrobacterium-mediated Transformation and Callus Induction of Sudan’s Cotton Genotypes
Glo. Adv. Res. J. Agric. Sci. April 2017 Vol: 6(4): - [Abstract] [Full Text - PDF] (1,727 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 371
Printed 378
Downloaded 197
Powered By iPortal Works