Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals


Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.


1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.


Accepted 14 March, 2017



Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles

Original Research Articles
Tag Alsir Altayeb Beshier Ahmed, Caroline Edward Ayad, Hussein Ahmed Hassan, Elsafi Ahmed Abdalla and Momen Abdou Elkhir
Characterization of Substantia Nigra in Parkinson disease using MR Imaging
Glo. Adv. Res. J. Agric. Sci. January 2015 Vol: 4(1): - [Abstract] [Full Text - PDF] (144 KB)
I Buraga, G Mihailescu, RM Anton, M Buraga and C Baetu
Hepathopathy in children and young patients – Do you think of Wilson’s Disease (Hepatolenticular Degeneration)?
Glo. Adv. Res. J. Agric. Sci. September 2014 Vol: 3(9): - [Abstract] [Full Text - PDF] (98 KB)
Kazuki Shimomae, So Makabe, Tanaphol Boriboonkaset, Dong Poh Chin,Tomoko Igawa, Raham Sher Khan, Masahiro Mii and Ikuo Nakamura
Enhanced efficiency of Agrobacterium-mediated transformation by sulfamethazine treatment in ravenna grass, Erianthus ravennae (L.) Beauv.
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (615 KB)
Alejandro Ulises Herrera-Romero, Germán Rubén Aguilar-Gutiérrez and Marcos Flores-Encarnación
Detection of Helicobacter pylori DNA in purified water for drinking
Glo. Adv. Res. J. Agric. Sci. April 2015 Vol: 4(4): - [Abstract] [Full Text - PDF] (233 KB)
Selva Prabhu A, Ananthan G, And Bala Subramanian T
First Record of Mitochondrial Cytochrome Oxidase I gene sequences of Ascidian Polyclinum madrasensis (Sebestian, 1952) from Gulf of Mannar, Southeast coast of India
Glo. Adv. Res. J. Agric. Sci. September 2012 Vol: 1(2): - [Abstract] [Full Text - PDF] (148 KB)
Isah Bala Ismail, Yahaya Mustapha and BS Aliyu
Micropropagation as a tool for experimental breeding, crop production and crop improvement
Glo. Adv. Res. J. Agric. Sci. December 2013 Vol: 2(12): - [Abstract] [Full Text - PDF] (154 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed


Viewed 509
Printed 401
Downloaded 246
Powered By iPortal Works