Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Kazuki Shimomae, So Makabe, Tanaphol Boriboonkaset, Dong Poh Chin,Tomoko Igawa, Raham Sher Khan, Masahiro Mii and Ikuo Nakamura
Enhanced efficiency of Agrobacterium-mediated transformation by sulfamethazine treatment in ravenna grass, Erianthus ravennae (L.) Beauv.
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (615 KB)
Elsayed M. Elazazi, Reda M. Rizk, Salwa D. Al-Kuwari, Subah S. Al-Marri, Baina Sh. Al-Marri, Essam O. H. saifelnasr and Naema A. Eltanger
Balanitesaegyptiaca: Firstrecord for the Flora in Qatar
Glo. Adv. Res. J. Agric. Sci. August 2015 Vol: 4(8): - [Abstract] [Full Text - PDF] (566 KB)
Mehmet Zeki Yildirim, Melikşah Turan, Vildan Oral and Afşin Ahmet Kaya
Determination of First Aid Information Levels of Students in Classroom Teaching Department: Sample of Burdur Mehmet Akif Ersoy University
Glo. Adv. Res. J. Agric. Sci. December 2018 Vol: 7(10): - [Abstract] [Full Text - PDF] (112 KB)
Rumyantsev SN
Invasion and parasite subsistence of human cancer
Glo. Adv. Res. J. Agric. Sci. November 2018 Vol: 7(9): - [Abstract] [Full Text - PDF] (389 KB)
Hisham N Altayb, Mohamed A M Siddig, Nagwa M El Amin, Ahmed Ibrahim Hashim, Maowia M. Mukhtar
Molecular Characterization of CTX-M ESBLs among Pathogenic Enterobacteriaceae isolated from different regions in Sudan
Glo. Adv. Res. J. Agric. Sci. April 2018 Vol: 7(2): - [Abstract] [Full Text - PDF] (1,351 KB)
Shehla Noreen, Atif Kamran and Asma Naeem
Foliar application of Zinc to improve growth, yield and grain content in rice (Oryza sativa L.)
Glo. Adv. Res. J. Agric. Sci. August 2019 Vol: 8(7): - [Abstract] [Full Text - PDF] (1,103 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 1805
Printed 2112
Downloaded 592
Powered By iPortal Works