Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Pramudji Hastuti, Izza Zukhrufia, Made Harumi Padmaswari, Afifah Nuraini and Ahmad Hamim Sadewa
Susceptibility of Lys656Asn Polymorphism of Leptin Receptor Gene to Hypertension in Obese Javanese subjects of Indonesia
Glo. Adv. Res. J. Agric. Sci. April 2016 Vol: 5(4): - [Abstract] [Full Text - PDF] (208 KB)
I Buraga, G Mihailescu, RM Anton, M Buraga and C Baetu
Hepathopathy in children and young patients – Do you think of Wilson’s Disease (Hepatolenticular Degeneration)?
Glo. Adv. Res. J. Agric. Sci. September 2014 Vol: 3(9): - [Abstract] [Full Text - PDF] (98 KB)
Tag Alsir Altayeb Beshier Ahmed, Caroline Edward Ayad, Hussein Ahmed Hassan, Elsafi Ahmed Abdalla and Momen Abdou Elkhir
Characterization of Substantia Nigra in Parkinson disease using MR Imaging
Glo. Adv. Res. J. Agric. Sci. January 2015 Vol: 4(1): - [Abstract] [Full Text - PDF] (144 KB)
Aga T, Atane G and Baba J
The Geology and Geotourism Potential of the Mayes Water Fall, North Central Nigeria
Glo. Adv. Res. J. Agric. Sci. October 2012 Vol: 1(1): - [Abstract] [Full Text - PDF] (2,171 KB)
Selva Prabhu A, Ananthan G, And Bala Subramanian T
First Record of Mitochondrial Cytochrome Oxidase I gene sequences of Ascidian Polyclinum madrasensis (Sebestian, 1952) from Gulf of Mannar, Southeast coast of India
Glo. Adv. Res. J. Agric. Sci. September 2012 Vol: 1(2): - [Abstract] [Full Text - PDF] (148 KB)
Herruzo R, Ruiz G, Burgos C, Perez-Blanco V, Gallego S, Mora E, Omenaca F
If you are looking for you can find endemic bla-VIM gene microorganisms, in Children's Hospitals
Glo. Adv. Res. J. Agric. Sci. May 2016 Vol: 5(4): - [Abstract] [Full Text - PDF] (280 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 317
Printed 366
Downloaded 174
Powered By iPortal Works