Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Pramudji Hastuti, Izza Zukhrufia, Made Harumi Padmaswari, Afifah Nuraini and Ahmad Hamim Sadewa
Susceptibility of Lys656Asn Polymorphism of Leptin Receptor Gene to Hypertension in Obese Javanese subjects of Indonesia
Glo. Adv. Res. J. Agric. Sci. April 2016 Vol: 5(4): - [Abstract] [Full Text - PDF] (208 KB)
Elsayed M. Elazazi, Reda M. Rizk, Salwa D. Al-Kuwari, Subah S. Al-Marri, Baina Sh. Al-Marri, Essam O. H. saifelnasr and Naema A. Eltanger
Balanitesaegyptiaca: Firstrecord for the Flora in Qatar
Glo. Adv. Res. J. Agric. Sci. August 2015 Vol: 4(8): - [Abstract] [Full Text - PDF] (566 KB)
Yassen, A.A; Abd El-Salam, A.M.E.; Salem, S.A; Sahar, M. Zaghloul and Khaled, S.M
Impact of Vermicompost on Growth; Development and Green Peach Aphid Myzus persicae Sulzer (Hemiptera: Aphididae) Infestations in Pot Marigold
Glo. Adv. Res. J. Agric. Sci. December 2015 Vol: 4(12): - [Abstract] [Full Text - PDF] (269 KB)
Mekkawy, IAA; Ahmed S. A. Harabawy; U. M. Mahmoud
Intra- and inter-specific variations in some isoenzymes and in eye-lens nucleus and muscle proteins of three Lethrinus species from the Red Sea at Hurghada, Egypt.
Glo. Adv. Res. J. Agric. Sci. February 2016 Vol: 5(2): - [Abstract] [Full Text - PDF] (1,391 KB)
Akintoye HA and AB Olaniyan
Yield of sweet corn in response to fertilizer sources
Glo. Adv. Res. J. Agric. Sci. July 2012 Vol: 1(5): - [Abstract] [Full Text - PDF] (120 KB)
Kazuki Shimomae, So Makabe, Tanaphol Boriboonkaset, Dong Poh Chin,Tomoko Igawa, Raham Sher Khan, Masahiro Mii and Ikuo Nakamura
Enhanced efficiency of Agrobacterium-mediated transformation by sulfamethazine treatment in ravenna grass, Erianthus ravennae (L.) Beauv.
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (615 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 262
Printed 357
Downloaded 160
Powered By iPortal Works