Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Article
Aga T, Atane G and Baba J
The Geology and Geotourism Potential of the Mayes Water Fall, North Central Nigeria
Glo. Adv. Res. J. Agric. Sci. October 2012 Vol: 1(1): - [Abstract] [Full Text - PDF] (2,171 KB)
Review
Isah Bala Ismail, Yahaya Mustapha and BS Aliyu
Micropropagation as a tool for experimental breeding, crop production and crop improvement
Glo. Adv. Res. J. Agric. Sci. December 2013 Vol: 2(12): - [Abstract] [Full Text - PDF] (154 KB)
Original Research Articles
Nada N. Nawar MD, Mona MA. Haleim MD, Rasha H. El Shereif MD, Amira FA. Hussein
Prevalence of Clostridium difficile among cases of antibiotics associated diarrhea in hospitalized patients in an Egyptian hospital
Glo. Adv. Res. J. Agric. Sci. July 2014 Vol: 3(6): - [Abstract] [Full Text - PDF] (371 KB)
Hana M Gashlan and Asma B Al-Beladi
Effects of Clove Oil on Liver and Antioxidant Status of Streptozotocin-Induced Diabetic Rats
Glo. Adv. Res. J. Agric. Sci. June 2017 Vol: 6(6): - [Abstract] [Full Text - PDF] (853 KB)
Mohamed T. Shaaban, M. Attia, Eman I. Mowafy, Azza Sh. Turky and Nemat M. Awad
Identification and Improving Antibiotic Production by Some Bacteria Isolated From Egyptian Soil
Glo. Adv. Res. J. Agric. Sci. September 2015 Vol: 4(9): - [Abstract] [Full Text - PDF] (1,296 KB)
Mervat EI Radwan, Abdel Fatah Ali and Omnea Abd el Hamied
Epidemiological studies, molecular diagnosis of anaplasma marginale in cattle and biochemical changes associated with it in Kaliobia Governorate
Glo. Adv. Res. J. Agric. Sci. February 2013 Vol: 2(2): - [Abstract] [Full Text - PDF] (354 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 410
Printed 384
Downloaded 209
Powered By iPortal Works