Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Article
I Wayan Suardana, Annisa Putri Cahyani and Komang Januartha Putra Pinatih
Probiotic Potency and Molecular Identification of Lactic Acid Bacteria Isolated from Bali Cattle’s Colon, Indonesia
Glo. Adv. Res. J. Agric. Sci. May 2016 Vol: 5(5): - [Abstract] [Full Text - PDF] (124 KB)
Review
Isah Bala Ismail, Yahaya Mustapha and BS Aliyu
Micropropagation as a tool for experimental breeding, crop production and crop improvement
Glo. Adv. Res. J. Agric. Sci. December 2013 Vol: 2(12): - [Abstract] [Full Text - PDF] (154 KB)
Original Research Articles
Tarek AA Moussa Rasha H ElSherif, Mohamed EA. Dawoud, Reham A. Dwedar and Nahla T. Muhammedy
Fecal carriage of extended-spectrum β-lactamase-producing Enterobactearicae: a comparative study between hospitalized and non-hospitalized patients.
Glo. Adv. Res. J. Agric. Sci. June 2014 Vol: 3(5): - [Abstract] [Full Text - PDF] (139 KB)
Mekkawy, IAA; Ahmed S. A. Harabawy; U. M. Mahmoud
Intra- and inter-specific variations in some isoenzymes and in eye-lens nucleus and muscle proteins of three Lethrinus species from the Red Sea at Hurghada, Egypt.
Glo. Adv. Res. J. Agric. Sci. February 2016 Vol: 5(2): - [Abstract] [Full Text - PDF] (1,391 KB)
Nada N. Nawar MD, Mona MA. Haleim MD, Rasha H. El Shereif MD, Amira FA. Hussein
Prevalence of Clostridium difficile among cases of antibiotics associated diarrhea in hospitalized patients in an Egyptian hospital
Glo. Adv. Res. J. Agric. Sci. July 2014 Vol: 3(6): - [Abstract] [Full Text - PDF] (371 KB)
Rehab M. Rizk; Magda I. Soliman and Eman M. EL-Zayat
Cytotoxic and Genotoxic Effects of some Narcotic plant extracts using Higher Plant Bioassay
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (1,402 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 188
Printed 289
Downloaded 132
Powered By iPortal Works