Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Hana M Gashlan and Asma B Al-Beladi
Effects of Clove Oil on Liver and Antioxidant Status of Streptozotocin-Induced Diabetic Rats
Glo. Adv. Res. J. Agric. Sci. June 2017 Vol: 6(6): - [Abstract] [Full Text - PDF] (853 KB)
Hind A. A. Al-Zahrani
Genetic mutagenesis through Transposable element 5 (Tn5) to improve beta-D-galactosidase productivity from different bacterial strains
Glo. Adv. Res. J. Agric. Sci. May 2018 Vol: 7(3): - [Abstract] [Full Text - PDF] (1,393 KB)
Yassen, A.A; Abd El-Salam, A.M.E.; Salem, S.A; Sahar, M. Zaghloul and Khaled, S.M
Impact of Vermicompost on Growth; Development and Green Peach Aphid Myzus persicae Sulzer (Hemiptera: Aphididae) Infestations in Pot Marigold
Glo. Adv. Res. J. Agric. Sci. December 2015 Vol: 4(12): - [Abstract] [Full Text - PDF] (269 KB)
Review
Kabeh JD
The Role of Biotechnology in Solving Global Food Crisis
Glo. Adv. Res. J. Agric. Sci. October 2012 Vol: 1(3): - [Abstract] [Full Text - PDF] (167 KB)
Original Research Article
Mehmet Zeki Yildirim, Melikşah Turan, Vildan Oral and Afşin Ahmet Kaya
Determination of First Aid Information Levels of Students in Classroom Teaching Department: Sample of Burdur Mehmet Akif Ersoy University
Glo. Adv. Res. J. Agric. Sci. December 2018 Vol: 7(10): - [Abstract] [Full Text - PDF] (112 KB)
Review
Peter Stride and Kylie Lopes Floro
Eyam’s Guardian Gene; C282Y, H63D or Delta 32?
Glo. Adv. Res. J. Agric. Sci. July 2015 Vol: 4(6): - [Abstract] [Full Text - PDF] (220 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 1443
Printed 2058
Downloaded 489
Powered By iPortal Works