Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Article
Shimekit Tadele, Firew Mekbib and Kassahun Tesfaye
Genetic Diversity of Coffee (Coffea arabica L.) Landraces from Southern Ethiopia as Revealed by Inter Simple Sequence Repeat Marker
Glo. Adv. Res. J. Agric. Sci. January 2014 Vol: 3(1): - [Abstract] [Full Text - PDF] (607 KB)
Review
Kabeh JD
The Role of Biotechnology in Solving Global Food Crisis
Glo. Adv. Res. J. Agric. Sci. October 2012 Vol: 1(3): - [Abstract] [Full Text - PDF] (167 KB)
Original Research Articles
Maria Angela Orsi, Luciana Helena Antoniassi da Silva, Clarice Weis Arns and Tânia Rosária Pereira Freitas
Evolutive phylogenetic based on amino acids sequence surround the fusion protein cleavage site gene of Newcastle disease virus from field samples of surveillance program and vaccine strains in Brazil
Glo. Adv. Res. J. Agric. Sci. March 2018 Vol: 7(3): - [Abstract] [Full Text - PDF] (545 KB)
Asmaa A. Alharbi
Molecular Characterization Using 16S rRNA Gene of Isolated Bacterial Genera Associated With Mango Cultivation in Jazan province, South West KSA
Glo. Adv. Res. J. Agric. Sci. September 2017 Vol: 6(9): - [Abstract] [Full Text - PDF] (1,669 KB)
Review
Peter Stride and Kylie Lopes Floro
Eyam’s Guardian Gene; C282Y, H63D or Delta 32?
Glo. Adv. Res. J. Agric. Sci. July 2015 Vol: 4(6): - [Abstract] [Full Text - PDF] (220 KB)
Original Research Article
So Makabe, Kynet Kong, Hiroyuki Niimi, Ikuo Nakamura
Growth profiles of transgenic tobacco plants expressing rice 45S rRNA gene
Glo. Adv. Res. J. Agric. Sci. February 2017 Vol: 6(2): - [Abstract] [Full Text - PDF] (2,139 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 816
Printed 438
Downloaded 310
Powered By iPortal Works