Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Asma Hassan, Shahzada Sohail Ijaz Muhmmad Ansar, Muhmmad Rasheed, Zuhair Husnain, Rizwan Shairdil and Lubna Ayub Durani
Impact of crop sequences and tillage systems on soil chemical properties of subtropical dry land
Glo. Adv. Res. J. Agric. Sci. October 2018 Vol: 7(10): - [Abstract] [Full Text - PDF] (418 KB)
Shimaa E. Ibrahim, Hala F Mohamed, Heba Sh. Shehata, and Rawheya A. Salah El Din
Perineal Plant Extract as a Culture Medium for Production of Plant Growth Regulators by Molecularly Identified Rhizospheric Microorganisms
Glo. Adv. Res. J. Agric. Sci. February 2020 Vol: 9(2): - [Abstract] [Full Text - PDF] (1,286 KB)
H. Abo Al-Yazeed, Amani M. Marwan, Attia, A. M., A. Samir, Ammar, A. M
Genetic Characterization of Campylobacter jejuni Isolated from Boiler Flocks
Glo. Adv. Res. J. Agric. Sci. June 2019 Vol: 8(4): - [Abstract] [Full Text - PDF] (683 KB)
Review
Najya A Attia
Neonatal Diabetes Mellitus: Clinical and Genetic Approach
Glo. Adv. Res. J. Agric. Sci. January 2018 Vol: 7(1): - [Abstract] [Full Text - PDF] (811 KB)
Original Research Articles
Kazuki Shimomae, So Makabe, Tanaphol Boriboonkaset, Dong Poh Chin,Tomoko Igawa, Raham Sher Khan, Masahiro Mii and Ikuo Nakamura
Enhanced efficiency of Agrobacterium-mediated transformation by sulfamethazine treatment in ravenna grass, Erianthus ravennae (L.) Beauv.
Glo. Adv. Res. J. Agric. Sci. November 2015 Vol: 4(11): - [Abstract] [Full Text - PDF] (615 KB)
Fernando Mejia Sanchez, Marisol Rodríguez Albarrán, J. Amado López Arriaga and Julieta Castillo Cadena
Heterogeneity of GST enzymatic activity before and after treatment in patients with breast cancer: pilot study
Glo. Adv. Res. J. Agric. Sci. July 2017 Vol: 6(7): - [Abstract] [Full Text - PDF] (311 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 1656
Printed 2088
Downloaded 550
Powered By iPortal Works