Global Advanced Research Journal of Agricultural Science (GARJAS) ISSN: 2315-5094
March 2017 Vol. 6(3): pp. 075-077
Copyright © 2016 Global Advanced Research Journals

 

Short Communication

Akt1 Molecular Identification in Bell Pepper

Pedro Alberto Rojas-Rojas1, Sixto Velarde-Felix2, Luis Alberto Lightbourn Rojas1, and *Saúl Parra-Terraza1.

 

1Plant nutrition, Facultad de Agronomía, Universidad Autónoma de Sinaloa, Culiacán, Sin., México.

2National Institute of Forest Agricultural Research And Livestock (INIFAP). And Road Culiacan-Eldorado Km. 17.5, Cp 80000. Culiacan Sinaloa. Mexico.

Email: saul.parra@uas.edu.mx

Accepted 14 March, 2017

 

Abstract

Ion channels play a fundamental role in maintaining cellular homeostasis, which is one of the most important processes in plant production. Potassium channels are particularly interesting as they transport nutrients, used by cells in physiological processes. The purpose of this work was detecting the gene codes for the potassium ion channel AKT1 in roots of bell pepper seedlings, the PCR was standardized for AKT1 detection, and the oligo: AAGATCAGATGCACCTTGACTT was synthesized (best aligned at a temperature of 62 °C), then it was sequenced and analyzed presenting an identity of 94-97% at NCBI with the gene AKT1.

Keywords: Plant nutrition, Capsicum, PCR, gene, sequence. 

Related Articles


Original Research Articles
Aga T, Atane G and Baba J
The Geology and Geotourism Potential of the Mayes Water Fall, North Central Nigeria
Glo. Adv. Res. J. Agric. Sci. October 2012 Vol: 1(1): - [Abstract] [Full Text - PDF] (2,171 KB)
So Makabe, Kynet Kong, Hiroyuki Niimi, Ikuo Nakamura
Growth profiles of transgenic tobacco plants expressing rice 45S rRNA gene
Glo. Adv. Res. J. Agric. Sci. February 2017 Vol: 6(2): - [Abstract] [Full Text - PDF] (2,139 KB)
Ramiro Enrique Cepeda Luna, Gabriel Arturo Pazmiño Solys, Washington Marcelo Gallardo Medina, Juan Enrique Ramos Guevara, Mónica Paulina Espinoza Guano and Luis Leonardo Guerrero Garcés
Cleaner production and the management of effluents in the Ecuadorian craft fisheries sector
Glo. Adv. Res. J. Agric. Sci. June 2017 Vol: 6(4): - [Abstract] [Full Text - PDF] (135 KB)
I Buraga, G Mihailescu, RM Anton, M Buraga and C Baetu
Hepathopathy in children and young patients – Do you think of Wilson’s Disease (Hepatolenticular Degeneration)?
Glo. Adv. Res. J. Agric. Sci. September 2014 Vol: 3(9): - [Abstract] [Full Text - PDF] (98 KB)
Iman K.A. Abdel Gadir, Marmar A. El Siddig, Hayfa H.A. Ibrahim and Adil A. El Hussein
Factors Affecting Agrobacterium-mediated Transformation and Callus Induction of Sudan’s Cotton Genotypes
Glo. Adv. Res. J. Agric. Sci. April 2017 Vol: 6(4): - [Abstract] [Full Text - PDF] (1,727 KB)
Elsayed M. Elazazi, Reda M. Rizk, Salwa D. Al-Kuwari, Subah S. Al-Marri, Baina Sh. Al-Marri, Essam O. H. saifelnasr and Naema A. Eltanger
Balanitesaegyptiaca: Firstrecord for the Flora in Qatar
Glo. Adv. Res. J. Agric. Sci. August 2015 Vol: 4(8): - [Abstract] [Full Text - PDF] (566 KB)

Current Issue

Viewing Options

View Full Article - PDF
Download Full Article - PDF

Search for Articles

Pedro Alberto Rojas-Rojas on Google Scholar
Pedro Alberto Rojas-Rojas on Pubmed
Sixto Velarde-Felix on Google Scholar
Sixto Velarde-Felix on Pubmed
Luis Alberto Lightbourn Rojas on Google Scholar
Luis Alberto Lightbourn Rojas on Pubmed
on Google Scholar
on Pubmed
Saúl Parra-Terraza on Google Scholar
Saúl Parra-Terraza on Pubmed

Statistics

Viewed 465
Printed 390
Downloaded 228
Powered By iPortal Works